ID: 934197815

View in Genome Browser
Species Human (GRCh38)
Location 2:89854730-89854752
Sequence ACCTAACAGAAATGACACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934197815_934197817 22 Left 934197815 2:89854730-89854752 CCAATGTGTCATTTCTGTTAGGT No data
Right 934197817 2:89854775-89854797 TACATAGATATTTATTAGACCGG No data
934197815_934197816 -8 Left 934197815 2:89854730-89854752 CCAATGTGTCATTTCTGTTAGGT No data
Right 934197816 2:89854745-89854767 TGTTAGGTTTAAAAGTTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934197815 Original CRISPR ACCTAACAGAAATGACACAT TGG (reversed) Intergenic
No off target data available for this crispr