ID: 934198162

View in Genome Browser
Species Human (GRCh38)
Location 2:89857662-89857684
Sequence TGCTCTAACCTGGACATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934198157_934198162 3 Left 934198157 2:89857636-89857658 CCTCAGCAAGGCCTTCCTATGTG No data
Right 934198162 2:89857662-89857684 TGCTCTAACCTGGACATAGGTGG No data
934198158_934198162 -8 Left 934198158 2:89857647-89857669 CCTTCCTATGTGTGCTGCTCTAA No data
Right 934198162 2:89857662-89857684 TGCTCTAACCTGGACATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934198162 Original CRISPR TGCTCTAACCTGGACATAGG TGG Intergenic
No off target data available for this crispr