ID: 934202060

View in Genome Browser
Species Human (GRCh38)
Location 2:89894279-89894301
Sequence CTTTCTGAAGGGCAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934202060_934202075 27 Left 934202060 2:89894279-89894301 CCCTTCACCTGCCCTTCAGAAAG No data
Right 934202075 2:89894329-89894351 ACACTAGGAACATGCTGGTAGGG No data
934202060_934202073 22 Left 934202060 2:89894279-89894301 CCCTTCACCTGCCCTTCAGAAAG No data
Right 934202073 2:89894324-89894346 CTGAGACACTAGGAACATGCTGG No data
934202060_934202069 -9 Left 934202060 2:89894279-89894301 CCCTTCACCTGCCCTTCAGAAAG No data
Right 934202069 2:89894293-89894315 TTCAGAAAGCCAGGCTTCGGGGG No data
934202060_934202071 12 Left 934202060 2:89894279-89894301 CCCTTCACCTGCCCTTCAGAAAG No data
Right 934202071 2:89894314-89894336 GGAGCTGCACCTGAGACACTAGG No data
934202060_934202074 26 Left 934202060 2:89894279-89894301 CCCTTCACCTGCCCTTCAGAAAG No data
Right 934202074 2:89894328-89894350 GACACTAGGAACATGCTGGTAGG No data
934202060_934202068 -10 Left 934202060 2:89894279-89894301 CCCTTCACCTGCCCTTCAGAAAG No data
Right 934202068 2:89894292-89894314 CTTCAGAAAGCCAGGCTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934202060 Original CRISPR CTTTCTGAAGGGCAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr