ID: 934203927

View in Genome Browser
Species Human (GRCh38)
Location 2:89909817-89909839
Sequence CTAGGGTTAAAGAGGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934203920_934203927 19 Left 934203920 2:89909775-89909797 CCAATATGGCTGCAGATGGAGAG No data
Right 934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG No data
934203919_934203927 22 Left 934203919 2:89909772-89909794 CCTCCAATATGGCTGCAGATGGA No data
Right 934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG No data
934203925_934203927 -8 Left 934203925 2:89909802-89909824 CCTGCTAGGAGGTAACTAGGGTT No data
Right 934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934203927 Original CRISPR CTAGGGTTAAAGAGGTGATC AGG Intergenic
No off target data available for this crispr