ID: 934210053

View in Genome Browser
Species Human (GRCh38)
Location 2:89967736-89967758
Sequence TATAGCTTCAACGCACAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934210051_934210053 5 Left 934210051 2:89967708-89967730 CCAGGTAGGGATACTTGTCTCTG No data
Right 934210053 2:89967736-89967758 TATAGCTTCAACGCACAGGTAGG No data
934210049_934210053 14 Left 934210049 2:89967699-89967721 CCTGCACACCCAGGTAGGGATAC No data
Right 934210053 2:89967736-89967758 TATAGCTTCAACGCACAGGTAGG No data
934210050_934210053 6 Left 934210050 2:89967707-89967729 CCCAGGTAGGGATACTTGTCTCT No data
Right 934210053 2:89967736-89967758 TATAGCTTCAACGCACAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934210053 Original CRISPR TATAGCTTCAACGCACAGGT AGG Intergenic
No off target data available for this crispr