ID: 934215367

View in Genome Browser
Species Human (GRCh38)
Location 2:90026976-90026998
Sequence CAGAATAACGGGAATGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934215360_934215367 26 Left 934215360 2:90026927-90026949 CCAGCTGGTGCAACCACTGTGGT No data
Right 934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG No data
934215361_934215367 13 Left 934215361 2:90026940-90026962 CCACTGTGGTCCTCAGATCTGCT No data
Right 934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG No data
934215363_934215367 3 Left 934215363 2:90026950-90026972 CCTCAGATCTGCTCTGGAAGAGT No data
Right 934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934215367 Original CRISPR CAGAATAACGGGAATGAGCC TGG Intergenic
No off target data available for this crispr