ID: 934215451

View in Genome Browser
Species Human (GRCh38)
Location 2:90027582-90027604
Sequence AGCCCACATCAGGTAGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934215451_934215463 19 Left 934215451 2:90027582-90027604 CCAAACCCTACCTGATGTGGGCT No data
Right 934215463 2:90027624-90027646 GCTGCCAATGGTCCCTGGAATGG No data
934215451_934215457 -7 Left 934215451 2:90027582-90027604 CCAAACCCTACCTGATGTGGGCT No data
Right 934215457 2:90027598-90027620 GTGGGCTGAATCCAGGCAGAGGG No data
934215451_934215459 -3 Left 934215451 2:90027582-90027604 CCAAACCCTACCTGATGTGGGCT No data
Right 934215459 2:90027602-90027624 GCTGAATCCAGGCAGAGGGGAGG No data
934215451_934215458 -6 Left 934215451 2:90027582-90027604 CCAAACCCTACCTGATGTGGGCT No data
Right 934215458 2:90027599-90027621 TGGGCTGAATCCAGGCAGAGGGG No data
934215451_934215456 -8 Left 934215451 2:90027582-90027604 CCAAACCCTACCTGATGTGGGCT No data
Right 934215456 2:90027597-90027619 TGTGGGCTGAATCCAGGCAGAGG No data
934215451_934215462 14 Left 934215451 2:90027582-90027604 CCAAACCCTACCTGATGTGGGCT No data
Right 934215462 2:90027619-90027641 GGGAGGCTGCCAATGGTCCCTGG No data
934215451_934215461 7 Left 934215451 2:90027582-90027604 CCAAACCCTACCTGATGTGGGCT No data
Right 934215461 2:90027612-90027634 GGCAGAGGGGAGGCTGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934215451 Original CRISPR AGCCCACATCAGGTAGGGTT TGG (reversed) Intergenic
No off target data available for this crispr