ID: 934220935

View in Genome Browser
Species Human (GRCh38)
Location 2:90082137-90082159
Sequence TCACCATTATCAAGAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934220935_934220937 11 Left 934220935 2:90082137-90082159 CCTGTCACTCTTGATAATGGTGA No data
Right 934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG No data
934220935_934220936 3 Left 934220935 2:90082137-90082159 CCTGTCACTCTTGATAATGGTGA No data
Right 934220936 2:90082163-90082185 TGTGAGTGCTGCATGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934220935 Original CRISPR TCACCATTATCAAGAGTGAC AGG (reversed) Intergenic
No off target data available for this crispr