ID: 934220935 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:90082137-90082159 |
| Sequence | TCACCATTATCAAGAGTGAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934220935_934220937 | 11 | Left | 934220935 | 2:90082137-90082159 | CCTGTCACTCTTGATAATGGTGA | No data | ||
| Right | 934220937 | 2:90082171-90082193 | CTGCATGCATTGAGGAAACATGG | No data | ||||
| 934220935_934220936 | 3 | Left | 934220935 | 2:90082137-90082159 | CCTGTCACTCTTGATAATGGTGA | No data | ||
| Right | 934220936 | 2:90082163-90082185 | TGTGAGTGCTGCATGCATTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934220935 | Original CRISPR | TCACCATTATCAAGAGTGAC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||