ID: 934220937

View in Genome Browser
Species Human (GRCh38)
Location 2:90082171-90082193
Sequence CTGCATGCATTGAGGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934220935_934220937 11 Left 934220935 2:90082137-90082159 CCTGTCACTCTTGATAATGGTGA No data
Right 934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934220937 Original CRISPR CTGCATGCATTGAGGAAACA TGG Intergenic
No off target data available for this crispr