ID: 934222655

View in Genome Browser
Species Human (GRCh38)
Location 2:90099617-90099639
Sequence CTGCATGCATTGAGGAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934222652_934222655 11 Left 934222652 2:90099583-90099605 CCTAGAGCTCTTGATAATGGTGG No data
Right 934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934222655 Original CRISPR CTGCATGCATTGAGGAAACA CGG Intergenic
No off target data available for this crispr