ID: 934223356

View in Genome Browser
Species Human (GRCh38)
Location 2:90106862-90106884
Sequence CAGGTACAGAAGGCAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934223356_934223363 15 Left 934223356 2:90106862-90106884 CCCAACACTGCCTTCTGTACCTG No data
Right 934223363 2:90106900-90106922 TATCCTAGAAATATAAGTAGAGG No data
934223356_934223365 30 Left 934223356 2:90106862-90106884 CCCAACACTGCCTTCTGTACCTG No data
Right 934223365 2:90106915-90106937 AGTAGAGGTGATCCTGATGCAGG No data
934223356_934223360 -8 Left 934223356 2:90106862-90106884 CCCAACACTGCCTTCTGTACCTG No data
Right 934223360 2:90106877-90106899 TGTACCTGGATAAACACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934223356 Original CRISPR CAGGTACAGAAGGCAGTGTT GGG (reversed) Intergenic
No off target data available for this crispr