ID: 934229386

View in Genome Browser
Species Human (GRCh38)
Location 2:90164610-90164632
Sequence CAGGTACAGCAGCCAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934229386_934229395 30 Left 934229386 2:90164610-90164632 CCCAACACTGGCTGCTGTACCTG No data
Right 934229395 2:90164663-90164685 AGTAGGGGTGATCATAAAGCAGG No data
934229386_934229391 13 Left 934229386 2:90164610-90164632 CCCAACACTGGCTGCTGTACCTG No data
Right 934229391 2:90164646-90164668 GATATCCTAGAAATACAAGTAGG No data
934229386_934229392 14 Left 934229386 2:90164610-90164632 CCCAACACTGGCTGCTGTACCTG No data
Right 934229392 2:90164647-90164669 ATATCCTAGAAATACAAGTAGGG No data
934229386_934229393 15 Left 934229386 2:90164610-90164632 CCCAACACTGGCTGCTGTACCTG No data
Right 934229393 2:90164648-90164670 TATCCTAGAAATACAAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934229386 Original CRISPR CAGGTACAGCAGCCAGTGTT GGG (reversed) Intergenic
No off target data available for this crispr