ID: 934233574

View in Genome Browser
Species Human (GRCh38)
Location 2:90209410-90209432
Sequence CTGCATGCATTGAGGAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934233571_934233574 11 Left 934233571 2:90209376-90209398 CCTGTAGCTCTTGATAATGGTGG No data
Right 934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934233574 Original CRISPR CTGCATGCATTGAGGAAACA CGG Intergenic
No off target data available for this crispr