ID: 934233574 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:90209410-90209432 |
| Sequence | CTGCATGCATTGAGGAAACA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934233571_934233574 | 11 | Left | 934233571 | 2:90209376-90209398 | CCTGTAGCTCTTGATAATGGTGG | No data | ||
| Right | 934233574 | 2:90209410-90209432 | CTGCATGCATTGAGGAAACACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934233574 | Original CRISPR | CTGCATGCATTGAGGAAACA CGG | Intergenic | ||
| No off target data available for this crispr | |||||