ID: 934236925

View in Genome Browser
Species Human (GRCh38)
Location 2:90240153-90240175
Sequence GCTCCTGGCAAGGCACAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934236919_934236925 15 Left 934236919 2:90240115-90240137 CCGCTGCGCTCATGACACTCTCA No data
Right 934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG No data
934236918_934236925 18 Left 934236918 2:90240112-90240134 CCACCGCTGCGCTCATGACACTC No data
Right 934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG No data
934236917_934236925 29 Left 934236917 2:90240101-90240123 CCACACAACTACCACCGCTGCGC No data
Right 934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934236925 Original CRISPR GCTCCTGGCAAGGCACAACC AGG Intergenic
No off target data available for this crispr