ID: 934240427

View in Genome Browser
Species Human (GRCh38)
Location 2:90267361-90267383
Sequence CGCTGGCCGAGGTGAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934240427_934240430 -10 Left 934240427 2:90267361-90267383 CCTGGACTTCACCTCGGCCAGCG No data
Right 934240430 2:90267374-90267396 TCGGCCAGCGAAGGAGAGAGAGG No data
934240427_934240431 -9 Left 934240427 2:90267361-90267383 CCTGGACTTCACCTCGGCCAGCG No data
Right 934240431 2:90267375-90267397 CGGCCAGCGAAGGAGAGAGAGGG No data
934240427_934240433 11 Left 934240427 2:90267361-90267383 CCTGGACTTCACCTCGGCCAGCG No data
Right 934240433 2:90267395-90267417 GGGTTAATGTTAACTGCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934240427 Original CRISPR CGCTGGCCGAGGTGAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr