ID: 934242250

View in Genome Browser
Species Human (GRCh38)
Location 2:90280261-90280283
Sequence GCGGGGGGGGGGAGACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934242250_934242271 25 Left 934242250 2:90280261-90280283 CCTGGATGTCTCCCCCCCCCCGC No data
Right 934242271 2:90280309-90280331 AGACCCCTTCTAAACCTGGGGGG No data
934242250_934242269 23 Left 934242250 2:90280261-90280283 CCTGGATGTCTCCCCCCCCCCGC No data
Right 934242269 2:90280307-90280329 AGAGACCCCTTCTAAACCTGGGG No data
934242250_934242270 24 Left 934242250 2:90280261-90280283 CCTGGATGTCTCCCCCCCCCCGC No data
Right 934242270 2:90280308-90280330 GAGACCCCTTCTAAACCTGGGGG No data
934242250_934242267 21 Left 934242250 2:90280261-90280283 CCTGGATGTCTCCCCCCCCCCGC No data
Right 934242267 2:90280305-90280327 CCAGAGACCCCTTCTAAACCTGG No data
934242250_934242268 22 Left 934242250 2:90280261-90280283 CCTGGATGTCTCCCCCCCCCCGC No data
Right 934242268 2:90280306-90280328 CAGAGACCCCTTCTAAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934242250 Original CRISPR GCGGGGGGGGGGAGACATCC AGG (reversed) Intergenic
No off target data available for this crispr