ID: 934272757

View in Genome Browser
Species Human (GRCh38)
Location 2:91549352-91549374
Sequence GGGTTAATGTTAACTGCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934272757_934272761 0 Left 934272757 2:91549352-91549374 CCTCGTGCAGTTAACATTAACCC No data
Right 934272761 2:91549375-91549397 TCTCTCTCCTTCGCTGGCCGAGG No data
934272757_934272763 11 Left 934272757 2:91549352-91549374 CCTCGTGCAGTTAACATTAACCC No data
Right 934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG No data
934272757_934272758 -6 Left 934272757 2:91549352-91549374 CCTCGTGCAGTTAACATTAACCC No data
Right 934272758 2:91549369-91549391 TAACCCTCTCTCTCCTTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934272757 Original CRISPR GGGTTAATGTTAACTGCACG AGG (reversed) Intergenic
No off target data available for this crispr