ID: 934272759

View in Genome Browser
Species Human (GRCh38)
Location 2:91549372-91549394
Sequence CGGCCAGCGAAGGAGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934272759_934272767 22 Left 934272759 2:91549372-91549394 CCCTCTCTCTCCTTCGCTGGCCG No data
Right 934272767 2:91549417-91549439 GTTCTGATGTCCACTCTCTCGGG No data
934272759_934272768 23 Left 934272759 2:91549372-91549394 CCCTCTCTCTCCTTCGCTGGCCG No data
Right 934272768 2:91549418-91549440 TTCTGATGTCCACTCTCTCGGGG No data
934272759_934272766 21 Left 934272759 2:91549372-91549394 CCCTCTCTCTCCTTCGCTGGCCG No data
Right 934272766 2:91549416-91549438 AGTTCTGATGTCCACTCTCTCGG No data
934272759_934272769 24 Left 934272759 2:91549372-91549394 CCCTCTCTCTCCTTCGCTGGCCG No data
Right 934272769 2:91549419-91549441 TCTGATGTCCACTCTCTCGGGGG No data
934272759_934272763 -9 Left 934272759 2:91549372-91549394 CCCTCTCTCTCCTTCGCTGGCCG No data
Right 934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934272759 Original CRISPR CGGCCAGCGAAGGAGAGAGA GGG (reversed) Intergenic