ID: 934272760

View in Genome Browser
Species Human (GRCh38)
Location 2:91549373-91549395
Sequence TCGGCCAGCGAAGGAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934272760_934272766 20 Left 934272760 2:91549373-91549395 CCTCTCTCTCCTTCGCTGGCCGA No data
Right 934272766 2:91549416-91549438 AGTTCTGATGTCCACTCTCTCGG No data
934272760_934272768 22 Left 934272760 2:91549373-91549395 CCTCTCTCTCCTTCGCTGGCCGA No data
Right 934272768 2:91549418-91549440 TTCTGATGTCCACTCTCTCGGGG No data
934272760_934272769 23 Left 934272760 2:91549373-91549395 CCTCTCTCTCCTTCGCTGGCCGA No data
Right 934272769 2:91549419-91549441 TCTGATGTCCACTCTCTCGGGGG No data
934272760_934272767 21 Left 934272760 2:91549373-91549395 CCTCTCTCTCCTTCGCTGGCCGA No data
Right 934272767 2:91549417-91549439 GTTCTGATGTCCACTCTCTCGGG No data
934272760_934272763 -10 Left 934272760 2:91549373-91549395 CCTCTCTCTCCTTCGCTGGCCGA No data
Right 934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934272760 Original CRISPR TCGGCCAGCGAAGGAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr