ID: 934272763

View in Genome Browser
Species Human (GRCh38)
Location 2:91549386-91549408
Sequence CGCTGGCCGAGGTGAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934272760_934272763 -10 Left 934272760 2:91549373-91549395 CCTCTCTCTCCTTCGCTGGCCGA No data
Right 934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG No data
934272759_934272763 -9 Left 934272759 2:91549372-91549394 CCCTCTCTCTCCTTCGCTGGCCG No data
Right 934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG No data
934272757_934272763 11 Left 934272757 2:91549352-91549374 CCTCGTGCAGTTAACATTAACCC No data
Right 934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934272763 Original CRISPR CGCTGGCCGAGGTGAAGTCC AGG Intergenic
No off target data available for this crispr