ID: 934273950

View in Genome Browser
Species Human (GRCh38)
Location 2:91563654-91563676
Sequence GATTTGCCCTGCCCCAACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934273950_934273955 18 Left 934273950 2:91563654-91563676 CCAACGTTGGGGCAGGGCAAATC No data
Right 934273955 2:91563695-91563717 GTCCATCTCTGGCCCTGCCTTGG No data
934273950_934273957 24 Left 934273950 2:91563654-91563676 CCAACGTTGGGGCAGGGCAAATC No data
Right 934273957 2:91563701-91563723 CTCTGGCCCTGCCTTGGCCCTGG No data
934273950_934273953 7 Left 934273950 2:91563654-91563676 CCAACGTTGGGGCAGGGCAAATC No data
Right 934273953 2:91563684-91563706 GACACTTCCAAGTCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934273950 Original CRISPR GATTTGCCCTGCCCCAACGT TGG (reversed) Intergenic
No off target data available for this crispr