ID: 934273952

View in Genome Browser
Species Human (GRCh38)
Location 2:91563680-91563702
Sequence AGATGGACTTGGAAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934273952_934273957 -2 Left 934273952 2:91563680-91563702 CCAGGACACTTCCAAGTCCATCT No data
Right 934273957 2:91563701-91563723 CTCTGGCCCTGCCTTGGCCCTGG No data
934273952_934273961 9 Left 934273952 2:91563680-91563702 CCAGGACACTTCCAAGTCCATCT No data
Right 934273961 2:91563712-91563734 CCTTGGCCCTGGCCCCTTCCTGG No data
934273952_934273967 26 Left 934273952 2:91563680-91563702 CCAGGACACTTCCAAGTCCATCT No data
Right 934273967 2:91563729-91563751 TCCTGGCCTGACCTTGTCCCTGG No data
934273952_934273955 -8 Left 934273952 2:91563680-91563702 CCAGGACACTTCCAAGTCCATCT No data
Right 934273955 2:91563695-91563717 GTCCATCTCTGGCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934273952 Original CRISPR AGATGGACTTGGAAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr