ID: 934273953

View in Genome Browser
Species Human (GRCh38)
Location 2:91563684-91563706
Sequence GACACTTCCAAGTCCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934273950_934273953 7 Left 934273950 2:91563654-91563676 CCAACGTTGGGGCAGGGCAAATC No data
Right 934273953 2:91563684-91563706 GACACTTCCAAGTCCATCTCTGG No data
934273944_934273953 23 Left 934273944 2:91563638-91563660 CCAGAGCAGGGCTGGACCAACGT No data
Right 934273953 2:91563684-91563706 GACACTTCCAAGTCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934273953 Original CRISPR GACACTTCCAAGTCCATCTC TGG Intergenic
No off target data available for this crispr