ID: 934273957

View in Genome Browser
Species Human (GRCh38)
Location 2:91563701-91563723
Sequence CTCTGGCCCTGCCTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934273950_934273957 24 Left 934273950 2:91563654-91563676 CCAACGTTGGGGCAGGGCAAATC No data
Right 934273957 2:91563701-91563723 CTCTGGCCCTGCCTTGGCCCTGG No data
934273952_934273957 -2 Left 934273952 2:91563680-91563702 CCAGGACACTTCCAAGTCCATCT No data
Right 934273957 2:91563701-91563723 CTCTGGCCCTGCCTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934273957 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG Intergenic
No off target data available for this crispr