ID: 934277895

View in Genome Browser
Species Human (GRCh38)
Location 2:91588804-91588826
Sequence GTTCCCCAACGGAGACCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934277891_934277895 -10 Left 934277891 2:91588791-91588813 CCTGGACCTCTGGGTTCCCCAAC No data
Right 934277895 2:91588804-91588826 GTTCCCCAACGGAGACCCTCGGG No data
934277888_934277895 3 Left 934277888 2:91588778-91588800 CCAGGCAGGATCACCTGGACCTC No data
Right 934277895 2:91588804-91588826 GTTCCCCAACGGAGACCCTCGGG No data
934277887_934277895 4 Left 934277887 2:91588777-91588799 CCCAGGCAGGATCACCTGGACCT No data
Right 934277895 2:91588804-91588826 GTTCCCCAACGGAGACCCTCGGG No data
934277883_934277895 26 Left 934277883 2:91588755-91588777 CCATCGGACGCTCGGACACGGAC No data
Right 934277895 2:91588804-91588826 GTTCCCCAACGGAGACCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934277895 Original CRISPR GTTCCCCAACGGAGACCCTC GGG Intergenic
No off target data available for this crispr