ID: 934282347

View in Genome Browser
Species Human (GRCh38)
Location 2:91623176-91623198
Sequence CAGCCCGAAGACTTTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934282347_934282351 -4 Left 934282347 2:91623176-91623198 CCCACCACAAAGTCTTCGGGCTG No data
Right 934282351 2:91623195-91623217 GCTGATTGTCAATGGTGCTGAGG No data
934282347_934282352 7 Left 934282347 2:91623176-91623198 CCCACCACAAAGTCTTCGGGCTG No data
Right 934282352 2:91623206-91623228 ATGGTGCTGAGGTAATCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934282347 Original CRISPR CAGCCCGAAGACTTTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr