ID: 934283254

View in Genome Browser
Species Human (GRCh38)
Location 2:91629654-91629676
Sequence ATGTTGTCATTGTTCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934283251_934283254 13 Left 934283251 2:91629618-91629640 CCTTCCTCTGGAGTTCTTGTGAT No data
Right 934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG No data
934283253_934283254 9 Left 934283253 2:91629622-91629644 CCTCTGGAGTTCTTGTGATGGCA No data
Right 934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG No data
934283250_934283254 16 Left 934283250 2:91629615-91629637 CCACCTTCCTCTGGAGTTCTTGT No data
Right 934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG No data
934283248_934283254 24 Left 934283248 2:91629607-91629629 CCCTGGAGCCACCTTCCTCTGGA No data
Right 934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG No data
934283249_934283254 23 Left 934283249 2:91629608-91629630 CCTGGAGCCACCTTCCTCTGGAG No data
Right 934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934283254 Original CRISPR ATGTTGTCATTGTTCAAGCC AGG Intergenic
No off target data available for this crispr