ID: 934285734

View in Genome Browser
Species Human (GRCh38)
Location 2:91649064-91649086
Sequence CTGTCTGCACAGTTGGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934285734_934285736 -4 Left 934285734 2:91649064-91649086 CCTAGGACCAACTGTGCAGACAG No data
Right 934285736 2:91649083-91649105 ACAGACAGACCCTCCTTCACAGG 0: 6
1: 0
2: 2
3: 22
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934285734 Original CRISPR CTGTCTGCACAGTTGGTCCT AGG (reversed) Intergenic
No off target data available for this crispr