ID: 934286841

View in Genome Browser
Species Human (GRCh38)
Location 2:91657786-91657808
Sequence CAGCTGGGTGGGGCAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934286841_934286849 0 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286849 2:91657809-91657831 TCCTGAGCCCAGAGGTCGGCTGG No data
934286841_934286856 20 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286856 2:91657829-91657851 TGGAGAGGGTCGGTCCTCTCTGG No data
934286841_934286860 29 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286860 2:91657838-91657860 TCGGTCCTCTCTGGGGTCCTGGG No data
934286841_934286861 30 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286861 2:91657839-91657861 CGGTCCTCTCTGGGGTCCTGGGG No data
934286841_934286857 21 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286857 2:91657830-91657852 GGAGAGGGTCGGTCCTCTCTGGG No data
934286841_934286851 5 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286851 2:91657814-91657836 AGCCCAGAGGTCGGCTGGAGAGG No data
934286841_934286846 -8 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286846 2:91657801-91657823 CCCAGCTGTCCTGAGCCCAGAGG No data
934286841_934286859 28 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286859 2:91657837-91657859 GTCGGTCCTCTCTGGGGTCCTGG No data
934286841_934286858 22 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286858 2:91657831-91657853 GAGAGGGTCGGTCCTCTCTGGGG No data
934286841_934286848 -4 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286848 2:91657805-91657827 GCTGTCCTGAGCCCAGAGGTCGG No data
934286841_934286852 6 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286852 2:91657815-91657837 GCCCAGAGGTCGGCTGGAGAGGG No data
934286841_934286855 10 Left 934286841 2:91657786-91657808 CCTGTGGCTGCCCCACCCAGCTG No data
Right 934286855 2:91657819-91657841 AGAGGTCGGCTGGAGAGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934286841 Original CRISPR CAGCTGGGTGGGGCAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr