ID: 934289121

View in Genome Browser
Species Human (GRCh38)
Location 2:91675917-91675939
Sequence TACTCCTTGATTGCAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934289121_934289126 16 Left 934289121 2:91675917-91675939 CCAAAGGCTGCAATCAAGGAGTA No data
Right 934289126 2:91675956-91675978 TCATCTGAAGGCTCAACTGAGGG 0: 7
1: 18
2: 28
3: 73
4: 265
934289121_934289125 15 Left 934289121 2:91675917-91675939 CCAAAGGCTGCAATCAAGGAGTA No data
Right 934289125 2:91675955-91675977 CTCATCTGAAGGCTCAACTGAGG 0: 15
1: 76
2: 220
3: 485
4: 840
934289121_934289123 -9 Left 934289121 2:91675917-91675939 CCAAAGGCTGCAATCAAGGAGTA No data
Right 934289123 2:91675931-91675953 CAAGGAGTAATATAAGGCTATGG 0: 6
1: 0
2: 0
3: 7
4: 126
934289121_934289124 4 Left 934289121 2:91675917-91675939 CCAAAGGCTGCAATCAAGGAGTA No data
Right 934289124 2:91675944-91675966 AAGGCTATGGTCTCATCTGAAGG 0: 6
1: 4
2: 25
3: 117
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934289121 Original CRISPR TACTCCTTGATTGCAGCCTT TGG (reversed) Intergenic
No off target data available for this crispr