ID: 934293273

View in Genome Browser
Species Human (GRCh38)
Location 2:91718650-91718672
Sequence AAATTCAAATTTGTGTGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934293273_934293275 19 Left 934293273 2:91718650-91718672 CCTATGCACACAAATTTGAATTT No data
Right 934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG No data
934293273_934293274 -2 Left 934293273 2:91718650-91718672 CCTATGCACACAAATTTGAATTT No data
Right 934293274 2:91718671-91718693 TTAAGTTAGCTTGATGTAGATGG No data
934293273_934293276 20 Left 934293273 2:91718650-91718672 CCTATGCACACAAATTTGAATTT No data
Right 934293276 2:91718693-91718715 GTCACCCCATTCCAAAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934293273 Original CRISPR AAATTCAAATTTGTGTGCAT AGG (reversed) Intergenic
No off target data available for this crispr