ID: 934293276

View in Genome Browser
Species Human (GRCh38)
Location 2:91718693-91718715
Sequence GTCACCCCATTCCAAAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934293273_934293276 20 Left 934293273 2:91718650-91718672 CCTATGCACACAAATTTGAATTT No data
Right 934293276 2:91718693-91718715 GTCACCCCATTCCAAAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934293276 Original CRISPR GTCACCCCATTCCAAAGCAT GGG Intergenic
No off target data available for this crispr