ID: 934294855

View in Genome Browser
Species Human (GRCh38)
Location 2:91734310-91734332
Sequence AAGAAGGCTGGAGGCAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934294855_934294867 27 Left 934294855 2:91734310-91734332 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934294867 2:91734360-91734382 AGTTGCTCTGTCATAGAACACGG No data
934294855_934294864 -5 Left 934294855 2:91734310-91734332 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934294864 2:91734328-91734350 TTCTTTGCAGGAGATGGATGGGG No data
934294855_934294862 -7 Left 934294855 2:91734310-91734332 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG No data
934294855_934294866 0 Left 934294855 2:91734310-91734332 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934294866 2:91734333-91734355 TGCAGGAGATGGATGGGGGTTGG No data
934294855_934294865 -4 Left 934294855 2:91734310-91734332 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934294865 2:91734329-91734351 TCTTTGCAGGAGATGGATGGGGG No data
934294855_934294863 -6 Left 934294855 2:91734310-91734332 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934294863 2:91734327-91734349 CTTCTTTGCAGGAGATGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934294855 Original CRISPR AAGAAGGCTGGAGGCAGGTC AGG (reversed) Intergenic
No off target data available for this crispr