ID: 934294862

View in Genome Browser
Species Human (GRCh38)
Location 2:91734326-91734348
Sequence CCTTCTTTGCAGGAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934294854_934294862 -6 Left 934294854 2:91734309-91734331 CCCTGACCTGCCTCCAGCCTTCT No data
Right 934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG No data
934294853_934294862 13 Left 934294853 2:91734290-91734312 CCTTGAAGATGCTGGTGTACCCT No data
Right 934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG No data
934294855_934294862 -7 Left 934294855 2:91734310-91734332 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934294862 Original CRISPR CCTTCTTTGCAGGAGATGGA TGG Intergenic
No off target data available for this crispr