ID: 934295992

View in Genome Browser
Species Human (GRCh38)
Location 2:91743280-91743302
Sequence GGCTGGAGAGCCTGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934295989_934295992 -6 Left 934295989 2:91743263-91743285 CCTATATCGGGGGGAGGGGCTGG No data
Right 934295992 2:91743280-91743302 GGCTGGAGAGCCTGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934295992 Original CRISPR GGCTGGAGAGCCTGAGGAGC AGG Intergenic
No off target data available for this crispr