ID: 934299401

View in Genome Browser
Species Human (GRCh38)
Location 2:91768322-91768344
Sequence CAGAATTGTCACTCTTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934299401_934299408 22 Left 934299401 2:91768322-91768344 CCTTGCTAAGAGTGACAATTCTG No data
Right 934299408 2:91768367-91768389 ACCTTGATCTGAGGGCTTAGAGG No data
934299401_934299404 -1 Left 934299401 2:91768322-91768344 CCTTGCTAAGAGTGACAATTCTG No data
Right 934299404 2:91768344-91768366 GGCAGGCTGCAGACCATGTGTGG 0: 4
1: 0
2: 4
3: 22
4: 275
934299401_934299407 14 Left 934299401 2:91768322-91768344 CCTTGCTAAGAGTGACAATTCTG No data
Right 934299407 2:91768359-91768381 ATGTGTGGACCTTGATCTGAGGG No data
934299401_934299406 13 Left 934299401 2:91768322-91768344 CCTTGCTAAGAGTGACAATTCTG No data
Right 934299406 2:91768358-91768380 CATGTGTGGACCTTGATCTGAGG No data
934299401_934299410 28 Left 934299401 2:91768322-91768344 CCTTGCTAAGAGTGACAATTCTG No data
Right 934299410 2:91768373-91768395 ATCTGAGGGCTTAGAGGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934299401 Original CRISPR CAGAATTGTCACTCTTAGCA AGG (reversed) Intergenic
No off target data available for this crispr