ID: 934300112

View in Genome Browser
Species Human (GRCh38)
Location 2:91771928-91771950
Sequence AGTAACTTGGGGCAGTTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 3, 1: 0, 2: 0, 3: 5, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934300103_934300112 27 Left 934300103 2:91771878-91771900 CCGCAGCTGTTCCTGGCTCAGAC 0: 4
1: 0
2: 1
3: 22
4: 354
Right 934300112 2:91771928-91771950 AGTAACTTGGGGCAGTTACCAGG 0: 3
1: 0
2: 0
3: 5
4: 94
934300106_934300112 16 Left 934300106 2:91771889-91771911 CCTGGCTCAGACTTCTTGGTGGG 0: 4
1: 0
2: 0
3: 16
4: 177
Right 934300112 2:91771928-91771950 AGTAACTTGGGGCAGTTACCAGG 0: 3
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934300112 Original CRISPR AGTAACTTGGGGCAGTTACC AGG Intergenic
902330649 1:15729679-15729701 AGAAACTTGGGGGAGAGACCTGG - Intronic
903443182 1:23403647-23403669 GATAACTTGGGGCAGTAACTTGG - Intronic
907217799 1:52880689-52880711 AGGAACTTGGGGCAGCTTCTAGG + Intronic
907376139 1:54042762-54042784 AGTAACTTGTTGCAGTTTCACGG - Intronic
913475471 1:119232897-119232919 AAGAATTTGGGGCAGTTACCAGG - Intergenic
914435418 1:147655142-147655164 AGAACCCAGGGGCAGTTACCTGG + Exonic
919727946 1:200895842-200895864 ACTACCTTGGGGAAGTCACCAGG - Intronic
919749302 1:201026517-201026539 AGCAACTTGGGGCAGCCATCTGG + Intergenic
924621277 1:245663184-245663206 AGTAAGCTGGGGCACTTACAAGG + Intronic
1063899583 10:10718682-10718704 CTTAACTTGGGTCAGTTTCCTGG - Intergenic
1064036902 10:11921396-11921418 TGTAACTTGGGGGAGTGACTTGG - Intronic
1067279674 10:44861640-44861662 AGTAGCTTTGGGAAGTCACCAGG - Intergenic
1074583165 10:114740622-114740644 AGTAACTTGAGACAGTAACTTGG + Intergenic
1076216398 10:128697242-128697264 AGAGACTTTGGGAAGTTACCAGG + Intergenic
1076437754 10:130458194-130458216 AGAAACTTGGGACAGTTTCCTGG - Intergenic
1077802396 11:5553208-5553230 AGTGAGTTGAAGCAGTTACCTGG - Intronic
1080044577 11:27795949-27795971 AGTAACTTGGGGCAGGTGAGAGG + Intergenic
1081198495 11:40189924-40189946 AGTAACTATAGGCAGTTCCCAGG - Intronic
1085605937 11:77898456-77898478 AGTAATTTGGGCCAGTTGGCCGG - Intronic
1086060702 11:82696830-82696852 AGTGCCTGGGGGCAGTTTCCAGG - Intergenic
1086646058 11:89222048-89222070 AGGAACATGGAACAGTTACCAGG + Intronic
1088784848 11:113172016-113172038 AGAAGCCTGGGACAGTTACCTGG + Intronic
1089083586 11:115798094-115798116 ATTAAATTGGGGCAGGCACCTGG - Intergenic
1090076140 11:123581118-123581140 AGTAACCTGGGTCTGTTTCCAGG + Intronic
1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG + Intergenic
1091896797 12:4111469-4111491 AGGAAGTTGGGGCAGAAACCAGG - Intergenic
1092569578 12:9708090-9708112 AGGAAGCTGGGGCAGTAACCAGG + Intergenic
1094750174 12:33397357-33397379 AGCAAGTGGGGACAGTTACCTGG + Intronic
1098014782 12:66092695-66092717 AGTAAGATGGGGTAGTTACCAGG + Intergenic
1100486021 12:95028281-95028303 TGTAAAATGGTGCAGTTACCTGG - Intronic
1103947634 12:124535373-124535395 AGCAACTTAGGGCAGTTTGCGGG - Intronic
1105214207 13:18274822-18274844 AGTAACTTGGGGCAGTTACCAGG - Intergenic
1105444929 13:20445347-20445369 GGAAGCCTGGGGCAGTTACCAGG - Intronic
1107272656 13:38638458-38638480 GGTGACGTGAGGCAGTTACCTGG - Intergenic
1108662986 13:52602945-52602967 TGTAACTTTGGGGAGTGACCTGG - Intergenic
1110543673 13:76733276-76733298 ACTCACTTGTGGAAGTTACCTGG - Intergenic
1110897839 13:80778143-80778165 AGTAATCTGGGGGTGTTACCAGG + Intergenic
1113498746 13:110756329-110756351 AGGAAATGGGGGCAGTTGCCTGG - Intergenic
1117349527 14:54867909-54867931 AGTAACTTGGTGGAGAAACCTGG + Intronic
1119114150 14:72002968-72002990 AGTTTCTTGGGCCAGTTCCCAGG - Intronic
1122696215 14:103553915-103553937 AGTGACTCTGGGCAGTTCCCTGG + Intergenic
1126771158 15:52057366-52057388 AGTAGCTTGGGGCAGATAATGGG - Intronic
1134464502 16:14462934-14462956 AGTAAACTGGGGCAGTCACTGGG - Intronic
1136599488 16:31275338-31275360 AGCAAGTTGGGGCAGAAACCCGG - Intronic
1139741915 16:69042587-69042609 ATTAACTTGGAGCACTCACCTGG + Intronic
1140073353 16:71672762-71672784 GGAAACATGGGGCAGTTCCCAGG - Intronic
1143312624 17:6005108-6005130 AGGAGCTTGGGGCAGTTTCTGGG - Intronic
1146682958 17:34821760-34821782 AGAAACTTGGAGCAGTTTCAAGG + Intergenic
1147746465 17:42697782-42697804 TGTACCTGGGGGCAGATACCAGG - Exonic
1151596932 17:75083866-75083888 TGGGCCTTGGGGCAGTTACCTGG - Intergenic
1152161805 17:78673489-78673511 AGTAAAGTGGGGCAGTCACCTGG + Intergenic
1155073102 18:22333270-22333292 AGTGTCTTGGGGCAGCCACCTGG - Intergenic
1162000223 19:7739935-7739957 ACTAAATTGGGTCAGTTCCCTGG + Intergenic
926323559 2:11765545-11765567 AATTACGTGGGGCAGTTAGCCGG + Exonic
926872490 2:17438322-17438344 AGGTCCTTGGGGCAATTACCAGG - Intergenic
928200075 2:29242203-29242225 AGAAACCTGGGGCAGTGAGCAGG - Intronic
928659253 2:33484126-33484148 ATTAACTTTGGGAAGATACCAGG + Intronic
929622496 2:43369684-43369706 AGTAACTTGGGGCACTGATGAGG - Intronic
930582684 2:53230932-53230954 AGTAACTTGTCTCTGTTACCAGG + Intergenic
934300112 2:91771928-91771950 AGTAACTTGGGGCAGTTACCAGG + Intergenic
937533489 2:122857950-122857972 AGGAACTTGTGTCAGGTACCAGG + Intergenic
942841387 2:180365822-180365844 AGTTTCCTGTGGCAGTTACCTGG - Intergenic
942998653 2:182297194-182297216 AGTAATTTTTGGCAGTTACAGGG + Intronic
945928409 2:215829587-215829609 GGTATCTTGGGTCAGTTTCCTGG - Intergenic
948808655 2:240463705-240463727 TGTGACTTGGGGCAGCTGCCAGG + Intronic
1174133901 20:48365536-48365558 AGAAACTTTTGGCAATTACCTGG - Intergenic
1178159725 21:29898004-29898026 AGTAACTTGCCCTAGTTACCAGG + Intronic
1179042374 21:37815528-37815550 AGTGACTCGGGGCAGGTAGCAGG + Intronic
1181486818 22:23236766-23236788 AGTAACTTTAGGCAGTCAGCTGG + Intronic
1181698465 22:24607058-24607080 AGTAACTTGGGGCAGTTACCAGG + Intronic
952709150 3:36411838-36411860 TGTAACTGGGGGCAGTCACTTGG + Intronic
956473366 3:69593017-69593039 AGTACCTTGAGGCCGTTACTGGG + Intergenic
960510003 3:118538220-118538242 ACTAACTTGTGGCAGTGAACTGG + Intergenic
964772204 3:160236246-160236268 AGAAACTTGGGACAGTACCCAGG - Intronic
966961641 3:184945798-184945820 AATAACTTGAGTCAGTTTCCTGG + Intronic
975363435 4:73499650-73499672 AGTACCTTGAGGCAGATGCCAGG + Intronic
982942979 4:161582173-161582195 AGTAACTTGTGGTATTTTCCGGG + Intronic
985869566 5:2543303-2543325 AGTGACTTGAGGCGGATACCCGG - Intergenic
988128106 5:27069092-27069114 AGTTACATGAGGCAGTTACGTGG - Intronic
992941727 5:81769210-81769232 AGTAACATGGGGCTGTTTCTTGG - Intergenic
993293314 5:86102974-86102996 AGTATCTTGGGATATTTACCAGG - Intergenic
994809266 5:104492042-104492064 TGTAATTTGGTGAAGTTACCTGG + Intergenic
1000875394 5:166631609-166631631 AGTAAGTTGGGGCAATTGTCAGG + Intergenic
1001614218 5:173029472-173029494 AGTAAGTTGGGGCAGAAATCAGG - Intronic
1012879434 6:104767871-104767893 AGTAAGATGGGGCAGGTATCAGG - Intronic
1017899726 6:158708828-158708850 GTGATCTTGGGGCAGTTACCTGG + Intronic
1019748777 7:2715745-2715767 AGTGACTTGGGACAGTCACCAGG + Exonic
1021754997 7:23843186-23843208 TCTAACTTGGGGCTGTTAGCAGG - Intergenic
1022911357 7:34902016-34902038 AGTAACTCGGCCCAGTAACCTGG - Intergenic
1025846671 7:65205572-65205594 AGTAATTTGGGCCAGTTGGCTGG + Intergenic
1025896917 7:65711461-65711483 AGTAATTTGGGCCAGTTGGCCGG + Intergenic
1028877834 7:95843434-95843456 TGTAACTTGGGGCAGTTGTAGGG + Intronic
1029367856 7:100127756-100127778 GGGAACTTGGGGCTGTTCCCAGG + Exonic
1030198615 7:106878550-106878572 AGTAATCTGGGGCAATTACAGGG + Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1043816913 8:84812767-84812789 ACCAACTTGGGGCTGTTAGCGGG - Intronic
1046307093 8:112383168-112383190 AGTACCTTGTAGCATTTACCTGG + Intronic
1053277941 9:36797580-36797602 AGTAACTTGGGCAAATTACTCGG - Intergenic
1056828329 9:89891947-89891969 GGTAACTTGGCGCTGTTTCCTGG - Intergenic
1060691487 9:125664919-125664941 AGTAACTTGGGAAAGTTATTTGG + Intronic
1187892851 X:23953408-23953430 AGTAGAATGGGGAAGTTACCGGG - Intergenic
1192661884 X:73050260-73050282 CCTCACTTGGGGCAGTTGCCAGG - Intergenic