ID: 934300312

View in Genome Browser
Species Human (GRCh38)
Location 2:91772789-91772811
Sequence AAGAAACAGACTTGTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934300312_934300319 15 Left 934300312 2:91772789-91772811 CCAGGCAGACAAGTCTGTTTCTT No data
Right 934300319 2:91772827-91772849 CAGCCCAGAACTGTCTTCTGAGG No data
934300312_934300314 -10 Left 934300312 2:91772789-91772811 CCAGGCAGACAAGTCTGTTTCTT No data
Right 934300314 2:91772802-91772824 TCTGTTTCTTCCTCCCCAGCGGG No data
934300312_934300322 21 Left 934300312 2:91772789-91772811 CCAGGCAGACAAGTCTGTTTCTT No data
Right 934300322 2:91772833-91772855 AGAACTGTCTTCTGAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934300312 Original CRISPR AAGAAACAGACTTGTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr