ID: 934304312

View in Genome Browser
Species Human (GRCh38)
Location 2:91809391-91809413
Sequence CGGCAAAAAGCTGCGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934304312_934304322 13 Left 934304312 2:91809391-91809413 CCCACCACCGCAGCTTTTTGCCG No data
Right 934304322 2:91809427-91809449 CTTATTGCCCCCCATCGCCGCGG No data
934304312_934304316 -10 Left 934304312 2:91809391-91809413 CCCACCACCGCAGCTTTTTGCCG No data
Right 934304316 2:91809404-91809426 CTTTTTGCCGCCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934304312 Original CRISPR CGGCAAAAAGCTGCGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr