ID: 934304580

View in Genome Browser
Species Human (GRCh38)
Location 2:91810366-91810388
Sequence CCGCGGCACGGTGGGCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934304580_934304595 18 Left 934304580 2:91810366-91810388 CCCCCCCGCCCACCGTGCCGCGG No data
Right 934304595 2:91810407-91810429 TCTTTGCACCCCCGCCGCCGCGG No data
934304580_934304591 -9 Left 934304580 2:91810366-91810388 CCCCCCCGCCCACCGTGCCGCGG No data
Right 934304591 2:91810380-91810402 GTGCCGCGGTTATTTACCGGCGG No data
934304580_934304593 -6 Left 934304580 2:91810366-91810388 CCCCCCCGCCCACCGTGCCGCGG No data
Right 934304593 2:91810383-91810405 CCGCGGTTATTTACCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934304580 Original CRISPR CCGCGGCACGGTGGGCGGGG GGG (reversed) Intergenic
No off target data available for this crispr