ID: 934305739

View in Genome Browser
Species Human (GRCh38)
Location 2:91820565-91820587
Sequence AGTTAACTGGAGAAGATGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305739_934305742 14 Left 934305739 2:91820565-91820587 CCGGTCATCTTCTCCAGTTAACT No data
Right 934305742 2:91820602-91820624 AGACAGCTCTTGTCCTATACTGG No data
934305739_934305744 24 Left 934305739 2:91820565-91820587 CCGGTCATCTTCTCCAGTTAACT No data
Right 934305744 2:91820612-91820634 TGTCCTATACTGGGCTTTTGTGG No data
934305739_934305743 15 Left 934305739 2:91820565-91820587 CCGGTCATCTTCTCCAGTTAACT No data
Right 934305743 2:91820603-91820625 GACAGCTCTTGTCCTATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305739 Original CRISPR AGTTAACTGGAGAAGATGAC CGG (reversed) Intergenic
No off target data available for this crispr