ID: 934305781

View in Genome Browser
Species Human (GRCh38)
Location 2:91820881-91820903
Sequence CCCCATGAGGTCATCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305781_934305788 11 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305788 2:91820915-91820937 AGCAGTTGACACAGGAAGGGAGG No data
934305781_934305791 23 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305791 2:91820927-91820949 AGGAAGGGAGGACTAGGGCCTGG No data
934305781_934305786 7 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305781_934305789 17 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305789 2:91820921-91820943 TGACACAGGAAGGGAGGACTAGG No data
934305781_934305787 8 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305787 2:91820912-91820934 TTGAGCAGTTGACACAGGAAGGG No data
934305781_934305790 18 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305790 2:91820922-91820944 GACACAGGAAGGGAGGACTAGGG No data
934305781_934305784 3 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305784 2:91820907-91820929 TGCCTTTGAGCAGTTGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305781 Original CRISPR CCCCATGAGGTCATCAGTGC AGG (reversed) Intergenic