ID: 934305786

View in Genome Browser
Species Human (GRCh38)
Location 2:91820911-91820933
Sequence TTTGAGCAGTTGACACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305777_934305786 14 Left 934305777 2:91820874-91820896 CCCGCGGCCTGCACTGATGACCT No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305775_934305786 26 Left 934305775 2:91820862-91820884 CCTGCCTTCTCTCCCGCGGCCTG No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305781_934305786 7 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305776_934305786 22 Left 934305776 2:91820866-91820888 CCTTCTCTCCCGCGGCCTGCACT No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305774_934305786 27 Left 934305774 2:91820861-91820883 CCCTGCCTTCTCTCCCGCGGCCT No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305783_934305786 -6 Left 934305783 2:91820894-91820916 CCTCATGGGGACTTGCCTTTGAG No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305778_934305786 13 Left 934305778 2:91820875-91820897 CCGCGGCCTGCACTGATGACCTC No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data
934305772_934305786 30 Left 934305772 2:91820858-91820880 CCACCCTGCCTTCTCTCCCGCGG No data
Right 934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305786 Original CRISPR TTTGAGCAGTTGACACAGGA AGG Intergenic