ID: 934305788

View in Genome Browser
Species Human (GRCh38)
Location 2:91820915-91820937
Sequence AGCAGTTGACACAGGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305778_934305788 17 Left 934305778 2:91820875-91820897 CCGCGGCCTGCACTGATGACCTC No data
Right 934305788 2:91820915-91820937 AGCAGTTGACACAGGAAGGGAGG No data
934305777_934305788 18 Left 934305777 2:91820874-91820896 CCCGCGGCCTGCACTGATGACCT No data
Right 934305788 2:91820915-91820937 AGCAGTTGACACAGGAAGGGAGG No data
934305776_934305788 26 Left 934305776 2:91820866-91820888 CCTTCTCTCCCGCGGCCTGCACT No data
Right 934305788 2:91820915-91820937 AGCAGTTGACACAGGAAGGGAGG No data
934305775_934305788 30 Left 934305775 2:91820862-91820884 CCTGCCTTCTCTCCCGCGGCCTG No data
Right 934305788 2:91820915-91820937 AGCAGTTGACACAGGAAGGGAGG No data
934305783_934305788 -2 Left 934305783 2:91820894-91820916 CCTCATGGGGACTTGCCTTTGAG No data
Right 934305788 2:91820915-91820937 AGCAGTTGACACAGGAAGGGAGG No data
934305781_934305788 11 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305788 2:91820915-91820937 AGCAGTTGACACAGGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305788 Original CRISPR AGCAGTTGACACAGGAAGGG AGG Intergenic