ID: 934305790

View in Genome Browser
Species Human (GRCh38)
Location 2:91820922-91820944
Sequence GACACAGGAAGGGAGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305778_934305790 24 Left 934305778 2:91820875-91820897 CCGCGGCCTGCACTGATGACCTC No data
Right 934305790 2:91820922-91820944 GACACAGGAAGGGAGGACTAGGG No data
934305777_934305790 25 Left 934305777 2:91820874-91820896 CCCGCGGCCTGCACTGATGACCT No data
Right 934305790 2:91820922-91820944 GACACAGGAAGGGAGGACTAGGG No data
934305785_934305790 -10 Left 934305785 2:91820909-91820931 CCTTTGAGCAGTTGACACAGGAA No data
Right 934305790 2:91820922-91820944 GACACAGGAAGGGAGGACTAGGG No data
934305781_934305790 18 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305790 2:91820922-91820944 GACACAGGAAGGGAGGACTAGGG No data
934305783_934305790 5 Left 934305783 2:91820894-91820916 CCTCATGGGGACTTGCCTTTGAG No data
Right 934305790 2:91820922-91820944 GACACAGGAAGGGAGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305790 Original CRISPR GACACAGGAAGGGAGGACTA GGG Intergenic