ID: 934305791

View in Genome Browser
Species Human (GRCh38)
Location 2:91820927-91820949
Sequence AGGAAGGGAGGACTAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305783_934305791 10 Left 934305783 2:91820894-91820916 CCTCATGGGGACTTGCCTTTGAG No data
Right 934305791 2:91820927-91820949 AGGAAGGGAGGACTAGGGCCTGG No data
934305785_934305791 -5 Left 934305785 2:91820909-91820931 CCTTTGAGCAGTTGACACAGGAA No data
Right 934305791 2:91820927-91820949 AGGAAGGGAGGACTAGGGCCTGG No data
934305778_934305791 29 Left 934305778 2:91820875-91820897 CCGCGGCCTGCACTGATGACCTC No data
Right 934305791 2:91820927-91820949 AGGAAGGGAGGACTAGGGCCTGG No data
934305781_934305791 23 Left 934305781 2:91820881-91820903 CCTGCACTGATGACCTCATGGGG No data
Right 934305791 2:91820927-91820949 AGGAAGGGAGGACTAGGGCCTGG No data
934305777_934305791 30 Left 934305777 2:91820874-91820896 CCCGCGGCCTGCACTGATGACCT No data
Right 934305791 2:91820927-91820949 AGGAAGGGAGGACTAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305791 Original CRISPR AGGAAGGGAGGACTAGGGCC TGG Intergenic