ID: 934305796

View in Genome Browser
Species Human (GRCh38)
Location 2:91820965-91820987
Sequence TGGGCGGTACCTGCCTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305796_934305805 27 Left 934305796 2:91820965-91820987 CCACAATAGGCAGGTACCGCCCA No data
Right 934305805 2:91821015-91821037 CCTTTCTAGGACATCCCTGCAGG No data
934305796_934305801 14 Left 934305796 2:91820965-91820987 CCACAATAGGCAGGTACCGCCCA No data
Right 934305801 2:91821002-91821024 AAGCACTACAGCCCCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305796 Original CRISPR TGGGCGGTACCTGCCTATTG TGG (reversed) Intergenic