ID: 934305801

View in Genome Browser
Species Human (GRCh38)
Location 2:91821002-91821024
Sequence AAGCACTACAGCCCCTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934305799_934305801 -5 Left 934305799 2:91820984-91821006 CCCAAAAGTGGACAGCTGAAGCA No data
Right 934305801 2:91821002-91821024 AAGCACTACAGCCCCTTTCTAGG No data
934305800_934305801 -6 Left 934305800 2:91820985-91821007 CCAAAAGTGGACAGCTGAAGCAC No data
Right 934305801 2:91821002-91821024 AAGCACTACAGCCCCTTTCTAGG No data
934305798_934305801 -2 Left 934305798 2:91820981-91821003 CCGCCCAAAAGTGGACAGCTGAA No data
Right 934305801 2:91821002-91821024 AAGCACTACAGCCCCTTTCTAGG No data
934305796_934305801 14 Left 934305796 2:91820965-91820987 CCACAATAGGCAGGTACCGCCCA No data
Right 934305801 2:91821002-91821024 AAGCACTACAGCCCCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934305801 Original CRISPR AAGCACTACAGCCCCTTTCT AGG Intergenic