ID: 934311950

View in Genome Browser
Species Human (GRCh38)
Location 2:91875316-91875338
Sequence AATATATAGCCTTCTCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934311950_934311953 11 Left 934311950 2:91875316-91875338 CCAGCATGAGAAGGCTATATATT No data
Right 934311953 2:91875350-91875372 AGTGTATGACAATCTGGAAAAGG No data
934311950_934311952 5 Left 934311950 2:91875316-91875338 CCAGCATGAGAAGGCTATATATT No data
Right 934311952 2:91875344-91875366 GTTCTAAGTGTATGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934311950 Original CRISPR AATATATAGCCTTCTCATGC TGG (reversed) Intergenic
No off target data available for this crispr