ID: 934311952

View in Genome Browser
Species Human (GRCh38)
Location 2:91875344-91875366
Sequence GTTCTAAGTGTATGACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934311950_934311952 5 Left 934311950 2:91875316-91875338 CCAGCATGAGAAGGCTATATATT No data
Right 934311952 2:91875344-91875366 GTTCTAAGTGTATGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934311952 Original CRISPR GTTCTAAGTGTATGACAATC TGG Intergenic
No off target data available for this crispr